FAQ

Tutaj znajdziesz odpowiedzi na najczęściej zadawane pytania.

Konto i płatności

Żeby założyć konto należy przesłać wypełniony formularz dostępny tutaj na adres amuseq@amu.edu.pl. Szczegółowe informacje jak założyć konto znajdziesz w zakładce Załóż konto.
Tak. W formularzu zakładania konta musisz wskazać kierownika projektu (prawdopodobnie promotora), który będzie finansował badania. W przypadku kiedy badania będą finansowane z Twojego grantu, jako kierownika projektu wskazujesz siebie.
  • Czas realizacji zamówienia to 4 dni robocze od momentu złożenia zamówienia i dostarczenia prób do analizy.
  • Czas realizacji zamówienia TapeStation w dni robocze to 24h.
  • Czas realizacji sekwencjonowania NGS ustalany jest indywidualnie.

Kierownik projektu to osoba, która finansuje badania. Może to być promotor, kierownik zakładu, osoba, która zarządza grantem realizowanym na UAM lub osoba w firmie odpowiedzialna za finansowanie badań.

Wynik są dostępne na koncie klienta przez min. 30 dni.
Dostarczone próby przechowywane są w Laboratorium przez 30 dni.
Tak, przed upływem 30 dni od daty realizacji zamówienia można odebrać próby. Do odebrania prób potrzebny jest numer zamówienia nadany przez Laboratorium.
Jeśli chcesz realizować kolejny projekt z innym źródłem płatności, prześlij wypełniony formularz z danymi nowego źródła płatności na adres amuseq@amu.edu.pl. Wszystkie formularze dostępne są tutaj.
Jeśli popełnisz błąd przy składaniu zamówienia, możesz je anulować wysyłając prośbę mailem na adres seq@amu.edu.pl i złożyć nowe poprawne zamówienie.
Tak, zamówienie można anulować do momentu, aż nie otrzyma statusu „Realizowane”. Wtedy anulowanie jest niemożliwe i zlecający ponosi koszty wykonanych analiz. Żeby anulować zamówienie należy wysłać e-mail na adres seq@amu.edu.pl.
Twoje zamówienie może mieć następujące statusy:
  • Oczekujące,
  • Przyjęte,
  • Realizowane – po otrzymaniu tego statusu zamówienie nie może zostać anulowane,
  • Wykonane,
  • Anulowane.

NGS i TapeStation

Nie, warunki sekwencjonowania NGS za każdym razem ustalamy indywidualnie. Prosimy o kontakt amungs@amu.edu.pl w celu ustalenia szczegółów.
Na bieżąco wykonujemy analizę przy użyciu odczynników i taśm Agilent High Sensitivity D1000. Jeśli chcą Państwo przeprowadzić analizę przy użyciu innych odczynników prosimy o kontakt mailowy amungs@amu.edu.pl.
  • Możliwy jest pomiar stężenia DNA w zakresie 10 – 1000 pg/µl
  • Zakres długości to 35 – 1000 bp
Minimalna objętość próby jaką należy dostarczyć to 5 µl.

Sekwencjonowanie Sangera

Dla każdej zgłaszanej próby należy wypełnić WSZYSTKIE komórki w wierszu formularza (z wyjątkiem kolumny Uwagi, która jest opcjonalna).
Niekompletne dane mogą opóźnić lub uniemożliwić realizację zamówienia.

Proszę zwrócić szczególną uwagę na informację zawartą w nagłówkach poszczególnych kolumn (czerwony trójkąt w prawym górnym rogu komórki).
Nie należy zmieniać struktury wewnętrznej i nazwy formularza, ponieważ uniemożliwi to przesłanie pliku i jego prawidłową interpretację.

W przypadku kiedy matryca DNA i starter dostarczane są osobno wybierz formularz: W przypadku kiedy matryca i starter są już wcześniej wymieszane wybierz formularz: Gdy dostarczony jest produkt sekwencjonowania uzyskany w innym laboratorium, gotowy do elektroforezy kapilarnej wybierz formularz: Jeżeli matryca przesłana do sekwencjonowania jest bogata w GC, ma stężenie niższe od wymaganego, posiada struktury drugorzędowe lub ma zostać odczytana sekwencja powyżej 700 nt wybierz formularz: Gdy ma zostać przeprowadzona elektroforeza kapilarna w celu rozróżnienia długości fragmentów znakowanych fluorescencyjnie wybierz formularz:
Nazwę wyniku otrzyma plik zawierający rezultat sekwencjonowania lub rozdziału elektroforetycznego.

Nazwa wyniku musi być UNIKALNA w obrębie jednego zamówienia!

Nazwa może zawierać następujące znaki:
  • litery [a-z A-Z (bez polskich znaków)]
  • cyfry [0-9]
  • podkreślenie, myślnik i kropkę [ _ – . ]
Wybór rodzaju filtra uzależniony jest od użytych barwników fluorescencyjnych, a standardu długości DNA od długości rozdzielanych fragmentów. Przy wyborze kieruj się poniższymi wskazówkami:
  • produkty analizy SNaPshot znakowane dR6G, dRROX, dRTAMRA, filtr E5 (DS-02) – standard LIZ120
  • fragmenty znakowane FAM, NED, PET, VIC, filtr G5 (DS-33) – standard LIZ120, LIZ600 lub LIZ1200
  • fragmenty znakowane FAM, JOE, NED, ROX, filtr F (DS-32) – standard ROX500
Jeśli nadal nie wiesz co wybrać, skontaktuj się z nami: seq@amu.edu.pl.
Probówki z matrycami najlepiej podpisać kolejnymi liczbami, a probówki ze starterami kolejnymi literami alfabetu.
Nazwy na probówkach muszą być identyczne z wpisanymi w formularzu w pozycjach, odpowiednio,  „Nazwa matrycy” i „Nazwa startera”.

Stripy muszą być podpisane na ściankach oraz na wieczkach kolejnymi liczbami (co najmniej pierwsza i ostatnia probówka w każdym stripie musi być podpisana).

Płytkę należy podpisać numerem zamówienia.
Mieszaninę matrycy i startera przygotuj w objętości 15 µl. W probówce wymieszaj:
  • 4,5 µl 10 µM startera,
  • odpowiednią ilość matrycy w zależności od rodzaju DNA:
    • 450 ng plazmidowego DNA,
    • 9 ng DNA/na każde 100 pz oczyszczonego produktu PCR o długości do 500 pz,
    • 15 ng DNA/na każde 100 pz oczyszczonego produktu PCR o długości powyżej 500 pz,
  • uzupełnij wodą do 15 µl.
Przygotowane reakcje możesz dostarczyć w probówkach 0,2 ml, w stripach lub na płytce.
Probówki 0,2 ml należy podpisać kolejnymi liczbami, płytkę – numerem zamówienia, a na stripach podpisy muszą znajdować się na ściankach oraz wieczkach co najmniej pierwszej i ostatniej probówki.

Do reakcji pobrane zostanie 5 µl. Prosimy jednak o przygotowanie większej objętości na wypadek ewentualnych powtórek.
Stężenie i wymagana objętość matrycy DNA do sekwencjonowania:
  1. Plazmid – Do sekwencjonowania przyjmujemy oczyszczony plazmidowy DNA w stężeniu 90 – 130 ng/µl (min. objętość to 3 µl na jedną reakcję). Jeśli stężenie Twojego preparatu jest niższe zgłoś sekwencjonowanie jako problemowe przy użyciu formularza: ProblemSeq.
  2. Produkt PCR – Do sekwencjonowania przyjmujemy produkty PCR ze zdjęciem żelu załączonym, jako Dodatkowe informacje (min. objętość to 3 µl na jedną reakcję).
  3. Jeśli chcesz odczytać sekwencję dłuższą niż 700 pz zgłoś sekwencjonowanie jako problemowe przy użyciu formularza: ProblemSeq.
Startery muszą mieć stężenie 10 μM. Prosimy o dostarczenie startera w objętości 5 µl na reakcję.
M13F-47 CGCCAGGGTTTTCCCAGTCACGAC
M13R TCACACAGGAAACAGCTATGAC
M13F-21 TGTAAAACGACGGCCAGT
M13R-21 CAGGAAACAGCTATGACC
T3 promoter ATTAACCCTCACTAAAGGGA
T7 universal primer TAATACGACTCACTATAGGG
T7 Terminator GCTAGTTATTGCTCAGCGG
SP6 TATTTAGGTGACACTATAG
ITS1_fun TCCGTAGGTGAACCTGCGG
ITS4_fun TCCTCCGCTTATTGATATGC
ITS5 GGAAGTAAAAGTCGTAACAAGG
EGFP-C CATGGTCCTGCTGGAGTTCG
EGFP-N CGTCGCCGTCCAGCTCGACCAG
pEGFP_CR CAGGGGGAGGTGTGGGAGGTT
umes_F GGAAGTAAAAGTCGTAACAA
umes_R TCCTCCGCTTATTGATATGC
piNDBAC5 GGATGTGCTGCAAGGCGATTAAGTTGG
piNDBAC3 CTCGTATGTTGTGTGGAATTGTGAGC
WPRE_R CATAGCGTAAAAGGACAACA
EF-1a_F TCAAGCCTCAGACAGTGGTTC
DN_new79_R ACACCCCGAGATTCTGAAACAAACTGGACACACCTC
DN_new117_F CGTGGATAGCGGTTTGACTCACGGGGATTTCCAAG
LucN_R CCTTATGCAGTTGCTCTCC
Podstawową metodą oceny jakości matrycy do sekwencjonowania jest elektroforeza w żelu agarozowym w obecności standardu długości DNA. Dotyczy to zarówno plazmidowego DNA jak i produktów PCR po oczyszczeniu na kolumienkach.

Na zdjęciu żelu muszą znaleźć się informacje dotyczące kolejności prób i nałożonej objętości oraz opis standardu długości DNA.

Tak. Żeby to zrobić w formularzu TubeSeq lub PlateSeq w kolumnie Do oczyszczania wpisz Tak.
  • Próby należy dostarczyć na portiernię Collegium Biologicum zapakowane w woreczek strunowy wraz z kartką z numerem zamówienia oraz imieniem i nazwiskiem osoby zamawiającej włożoną do woreczka.
  • DNA możesz dostarczyć w probówkach 0,2 µl lub 1,5 ml, w stripach lub na płytce.
  • Probówki 0,2 ml należy podpisać kolejnymi liczbami, płytkę – numerem zamówienia, a na stripach podpisy muszą znajdować się na ściankach oraz wieczkach, co najmniej pierwszej i ostatniej probówki.
  • Nazwy na probówkach muszą być identyczne z wpisanymi w formularzu w pozycji „Nazwa matrycy” i „Nazwa startera”. Nazwa płytki musi być identyczna z numerem zamówienia.
  • Wszelkie nieścisłości będą wymagały dodatkowego kontaktu z zamawiającym i mogą spowodować wydłużenie czasu realizacji zamówienia.
  • Do woreczka strunowego włóż probówki lub szczelnie zaklejoną płytkę. Probówek nie należy zabezpieczać parafilmem.
  • Dołącz kartkę z nazwiskiem osoby zamawiającej oraz numerem zamówienia.
  • Zapakuj worek z próbami do koperty bąbelkowej i wyślij na nasz adres.
  • Dokładanie chłodzików nie jest konieczne.
Sekwencjonowanie jest niestandardowe lub problemowe, jeśli:
  • stężenie matrycy jest niższe od wymaganego,
  • sekwencja jest bogata w GC,
  • w sekwencji występują struktury drugorzędowe,
  • oczekiwany odczyt ma być dłuższy niż 700 pz.
Nie. Matrycę i starter należy dostarczyć w osobnych probówkach. Należy wybrać formularz ProblemSeq.
Do przeglądania chromatogramów, edycji i eksportu danych możesz użyć ogólnodostępnych i darmowych programów. W przypadku sekwencjonowania są to:
  • Sequence Scanner (Thermo Fisher Scientific, Download),
  • Finch TV (Digital World Biology, Download),
  • Chromas Lite (Technelysium, Download).
Do analizy fragmentów (SNaPhot i produkty PCR) można korzystać z programu PeakScanner (Thermo Fisher Scientific, Download).
Created my free logo at LogoMakr.com | Icons made by Eucalyp from www.flaticon.com