Q&A
Frequently asked questions.
Customer account and payment
To set up an account, please send a completed form by
e-mail to amuseq@amu.edu.pl.
All forms are available here.
e-mail to amuseq@amu.edu.pl.
All forms are available here.
Yes. In the account creation form, you must indicate the project manager (probably your thesis supervisor) who will finance the research. If the research is financed by your grant, you designate yourself as the project manager.
Delivery time is up to 4 working days from the moment of placing the order and delivering the samples for analysis. The time of NGS sequencing is set individually.
The project manager is the person who funds the research. This may be your thesis supervisior, head of department, a person who manages the AMU grant or a person in the company responsible for research funding.
The result is available in the customer’s account for at least 30 days.
The delivered samples are stored in the Laboratory
for 30 days.
Yes, samples can be pick up within 30 days from the date of order fulfillment. To pick up the samples, you need the order number assigned by the Laboratory.
If you want to place an order with a new source of payment, download the appropriate form
fill it in and send to amuseq@amu.edu.pl. All forms are available here.
If you make a mistake when placing an order, you can cancel it by sending an e-mail to seq@amu.edu.pl and place a new proper order.
Yes, you can cancel your order until it receives the “Realizowane” status. After that the cancellation is impossible and the purchaser bears the costs of the analyzes performed.
To cancel an order, please send an e-mail to seq@amu.edu.pl .
- Oczekujące (= pending),
- Przyjęte (= accepted),
- Realizowane (= processing) – the order cannot be canceled when it has got this status,
- Wykonane (= processed),
- Anulowane (= canceled).
NGS and TapeStation
No, the conditions of NGS sequencing are set individually each time. Please contact amungs@amu.edu.pl for details.
We perform the analysis on an ongoing basis using Agilent High Sensitivity D1000 reagents and tapes. If you want to carry out the analysis using other reagents, please contact us by e-mail amungs@amu.edu.pl.
It is possible to measure DNA concentration in the range 10 – 1000 pg/µl. The length range is 35 – 1000 bp.
The minimum sample volume to be delivered is 5 µl.
Sequencing and capillary electrophoresis
For each sample, ALL cells in the form row should be completed (except for the Notes column, which is optional). Incomplete data may delay the order or even prevent the order from being processed.
Please make sure to save the file before sending it!
Please pay special attention to the information contained in the headings of individual columns (red triangle in the upper right corner of the cell).
or name of the downloaded form as this will
prevent you from placing an order.
In case the template DNA and primer are provided separately, select the form: In case the template DNA and primer are already mixed, select the form:
- ReadyToSeqTube (tubes),
- ReadyToSeqPlate (plates).
- ReadyToLoadTube (tubes),
- ReadyToLoadPlate (plates).
- FragmentAnalysisTube (tubes),
- FragmentAnalysisPlate (plates).
A file containing the result of the sequencing or electrophoretic separation will be given the name of the result.
The name of the result must be UNIQUE within one order!
The name may contain the following characters:
The name of the result must be UNIQUE within one order!
The name may contain the following characters:
- letters [a-z A-Z (without Polish characters)]
- numbers [0-9]
- underscore, dash and period [_ -. ]
The choice of the filter type depends on the used fluorescent dyes, and the size standard depends on the length of the separated fragments.
When choosing, follow the list below:
- SNaPshot products labeled with dR6G, dRROX, dRTAMRA: filter E5 (DS-02) – LIZ120 standard,
- fragments labeled 6FAM, LIZ, NED, PET, VIC: filter G5 (DS-33) – LIZ120, LIZ600 or LIZ1200 standards,
- fragments labeled 6FAM, JOE, NED, ROX): filter F (DS-32) – ROX500 standard.
The tubes with template DNA are best signed with consecutive numbers, and the tubes with primers with successive letters of the alphabet.
The names on the TUBES must be identical to those entered on the form under “Template name/Nazwa matrycy” and “Primer name/Nazwa startera”, respectively.
STRIPS must be signed on the sides and on the lids with consecutive numbers (at least the first and last tube in each strip must be signed).
PLATE should be signed with the order number.
The names on the TUBES must be identical to those entered on the form under “Template name/Nazwa matrycy” and “Primer name/Nazwa startera”, respectively.
STRIPS must be signed on the sides and on the lids with consecutive numbers (at least the first and last tube in each strip must be signed).
PLATE should be signed with the order number.
Prepare the DNA template and primer mixture in the volume of 15 µl.
In a tube, mix:
0.2 ml TUBES should be signed with consecutive numbers, the PLATE – with the order number, and on the STRIPS, signatures must be placed on the sides and lids of at least the first and the last tube.
5 µl will be taken for the reaction. However, we please to prepare a larger volume in case of possible repetitions.
- 4.5 µl of 10 µM primer,
- the right amount of template depending on the type of DNA:
- 450 ng of plasmid DNA,
- 9 ng DNA/for every 100 bp of purified PCR product up to 500 bp in length,
- 15 ng DNA/for every 100 bp of purified PCR product over 500 bp in length,
- make up to 15 µl with water.
0.2 ml TUBES should be signed with consecutive numbers, the PLATE – with the order number, and on the STRIPS, signatures must be placed on the sides and lids of at least the first and the last tube.
5 µl will be taken for the reaction. However, we please to prepare a larger volume in case of possible repetitions.
Concentration and required volume of DNA template for sequencing:
- Plasmid – we accept purified plasmid DNA in a concentration of 90 – 130 ng/µl (minimum volume is 3 µl per one reaction). If the concentration of your sample is lower, order the sequencing using the form: ProblemSeq.
- PCR product – we accept PCR products with the photo of the gel attached as Dodatkowe informacje (minimum volume is 3 µl per one reaction).
- If you want to read a sequence above 700 bp please send the form: ProblemSeq.
Primers must have a concentration of 10 µM. Please provide 5 µl of primer per one reaction.
| M13F-47 | CGCCAGGGTTTTCCCAGTCACGAC |
|---|---|
| M13R | TCACACAGGAAACAGCTATGAC |
| M13F-21 | TGTAAAACGACGGCCAGT |
| M13R-21 | CAGGAAACAGCTATGACC |
| T3 promoter | ATTAACCCTCACTAAAGGGA |
| T7 universal primer | TAATACGACTCACTATAGGG |
| T7 Terminator | GCTAGTTATTGCTCAGCGG |
| SP6 | TATTTAGGTGACACTATAG |
| ITS1_fun | TCCGTAGGTGAACCTGCGG |
| ITS4_fun | TCCTCCGCTTATTGATATGC |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG |
| EGFP-C | CATGGTCCTGCTGGAGTTCG |
| EGFP-N | CGTCGCCGTCCAGCTCGACCAG |
| pEGFP_CR | CAGGGGGAGGTGTGGGAGGTT |
| umes_F | GGAAGTAAAAGTCGTAACAA |
| umes_R | TCCTCCGCTTATTGATATGC |
| piNDBAC5 | GGATGTGCTGCAAGGCGATTAAGTTGG |
| piNDBAC3 | CTCGTATGTTGTGTGGAATTGTGAGC |
| WPRE_R | CATAGCGTAAAAGGACAACA |
| EF-1a_F | TCAAGCCTCAGACAGTGGTTC |
| DN_new79_R | ACACCCCGAGATTCTGAAACAAACTGGACACACCTC |
| DN_new117_F | CGTGGATAGCGGTTTGACTCACGGGGATTTCCAAG |
| LucN_R | CCTTATGCAGTTGCTCTCC |
The primary method for assessing the quality of a sequencing template is agarose gel electrophoresis in the presence of a DNA length standard. This applies to both plasmid DNA and PCR products after column purification.
The photo of the gel must contain information of the order of samples and the volume applied, and a description of the DNA length standard.
- The samples should be delivered to the laboratory packed in a string bag with an attached sheet with order number and contact info of ordering person.
- You can deliver DNA in 0.2 µl or 1.5 ml tubes, in strips or on the plate.
- The names on the tubes must be identical to those entered in the form under “Template name/Nazwa matrycy” and “Primer name/Nazwa startera”. The name of the plate must be identical to the order number.
- Any inaccuracies will require additional contact with the ordering person and may extend the order fulfillment time.
- Put the tubes or the sealed plate into the zip-bag. Tubes should not be secured with parafilm.
- Add sheet with contact info of ordering person.
- Pack the sample bag in a bubble envelope and ship it to our address.
- It is not necessary to add coolers.
Sequencing is nonstandard or problematic, if template concentration is lower than required, the sequence is GC rich, there are secondary structures in the sequence, or the expected read length is longer than 700 bp.
No. Template and primer should be delivered in separate tubes.
You should choose the ProblemSeq form.
You can use free software to view, edit and export data from sequence chromatograms:
- Sequence Scanner (Thermo Fisher Scientific, Download),
- Finch TV (Digital World Biology, Download),
- Chromas Lite (Technelysium, Download).